Antibodies
Anti-TPPP Antibody-Oligo Conjugate
SKU: aoc3664
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TPPP Antibody-IF1
Antibody Target
- Target
- Tubulin polymerization-promoting protein
- UniProt Number
- O94811
- Target Description
- Regulator of microtubule dynamics that plays a key role in myelination by promoting elongation of the myelin sheath. Acts as a microtubule nucleation factor in oligodendrocytes: specifically localizes to the postsynaptic Golgi apparatus region, also named Golgi outpost, and promotes microtubule nucleation, an important step for elongation of the myelin sheath. Required for both uniform polarized growth of distal microtubules as well as directing the branching of proximal processes. Shows magnesium-dependent GTPase activity; the role of the GTPase activity is unclear. In addition to microtubule nucleation activity, also involved in microtubule bundling and stabilization of existing microtubules, thereby maintaining the integrity of the microtubule network. Regulates microtubule dynamics by promoting tubulin acetylation: acts by inhibiting the tubulin deacetylase activity of HDAC6. Also regulates cell migration: phosphorylation by ROCK1 inhibits interaction with HDAC6, resulting in decreased acetylation of tubulin and increased cell motility. Plays a role in cell proliferation by regulating the G1/S-phase transition. Involved in astral microtubule organization and mitotic spindle orientation during early stage of mitosis; this process is regulated by phosphorylation by LIMK2.
- Molecular Weight
- 24kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1129
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat