Antibodies
Anti-TRADD Antibody-Oligo Conjugate
SKU: aoc3666
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-TRADD Antibody-PLA1
Antibody Target
- Target
- Tumor necrosis factor receptor type 1-associated DEATH domain protein
- UniProt Number
- Q15628
- Target Description
- Adapter molecule for TNFRSF1A/TNFR1 that specifically associates with the cytoplasmic domain of activated TNFRSF1A/TNFR1 mediating its interaction with FADD. Overexpression of TRADD leads to two major TNF-induced responses, apoptosis and activation of NF-kappa-B. The nuclear form acts as a tumor suppressor by preventing ubiquitination and degradation of isoform p19ARF/ARF of CDKN2A by TRIP12: acts by interacting with TRIP12, leading to disrupt interaction between TRIP12 and isoform p19ARF/ARF of CDKN2A.
- Molecular Weight
- 34 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC66711
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat