Antibodies
Anti-TRAF2 Antibody-Oligo Conjugate
SKU: aoc3667
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-TRAF2 Antibody-PLA1
Antibody Target
- Target
- TNF receptor-associated factor 2
- UniProt Number
- Q12933
- Target Description
- E3 ubiquitin-protein ligase that regulates activation of NF-kappa-B and JNK and plays a central role in the regulation of cell survival and apoptosis. Catalyzes 'Lys-63'-linked ubiquitination of target proteins, such as BIRC3, IKBKE, MLST8, RIPK1 and TICAM1. Is an essential constituent of several E3 ubiquitin-protein ligase complexes, where it promotes the ubiquitination of target proteins by bringing them into contact with other E3 ubiquitin ligases. Regulates BIRC2 and BIRC3 protein levels by inhibiting their autoubiquitination and subsequent degradation; this does not depend on the TRAF2 RING-type zinc finger domain. Plays a role in mediating activation of NF-kappa-B by EIF2AK2/PKR. In complex with BIRC2 or BIRC3, promotes ubiquitination of IKBKE. Acts as a regulator of mTORC1 and mTORC2 assembly by mediating 'Lys-63'-linked ubiquitination of MLST8, thereby inhibiting formation of the mTORC2 complex, while facilitating assembly of the mTORC1 complex. Required for normal antibody isotype switching from IgM to IgG.
- Molecular Weight
- 53kDa/54kDa/55kDa/61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC51292
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat