Antibodies
Anti-TRAF6 Antibody-Oligo Conjugate
SKU: aoc3669
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TRAF6 Antibody-IF1
Antibody Target
- Target
- TNF receptor-associated factor 6
- UniProt Number
- Q9Y4K3
- Target Description
- E3 ubiquitin ligase that, together with UBE2N and UBE2V1, mediates the synthesis of 'Lys-63'-linked-polyubiquitin chains conjugated to proteins, such as ECSIT, IKBKG, IRAK1, AKT1 and AKT2. Also mediates ubiquitination of free/unanchored polyubiquitin chain that leads to MAP3K7 activation. Leads to the activation of NF-kappa-B and JUN. Seems to also play a role in dendritic cells (DCs) maturation and/or activation. Represses c-Myb-mediated transactivation, in B-lymphocytes. Adapter protein that seems to play a role in signal transduction initiated via TNF receptor, IL-1 receptor and IL-17 receptor. Regulates osteoclast differentiation by mediating the activation of adapter protein complex 1 (AP-1) and NF-kappa-B, in response to RANK-L stimulation. Together with MAP3K8, mediates CD40 signals that activate ERK in B-cells and macrophages, and thus may play a role in the regulation of immunoglobulin production. Acts as a regulator of the JNK and NF-kappa-B signaling pathways by initiating assembly of heterotypic 'Lys-63'-/'Lys-48'-linked branched ubiquitin chains that are then recognized by TAB2: TRAF6 catalyzes initial 'Lys-63'-linked-polyubiquitin chains that are then branched via 'Lys-48'-linked polyubiquitin by HUWE1. 'Lys-63'-/'Lys-48'-linked branched ubiquitin chains protect 'Lys-63'-linkages from CYLD deubiquitination. Participates also in the TCR signaling by ubiquitinating LAT.
- Molecular Weight
- 60 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC60027
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat