Antibodies
Anti-Transferrin Antibody-Oligo Conjugate
SKU: aoc3671
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Transferrin Antibody-IF1
Antibody Target
- Target
- Serotransferrin
- UniProt Number
- P02787
- Target Description
- Transferrins are iron binding transport proteins which can bind two Fe(3+) ions in association with the binding of an anion, usually bicarbonate. It is responsible for the transport of iron from sites of absorption and heme degradation to those of storage and utilization. Serum transferrin may also have a further role in stimulating cell proliferation.; FUNCTION: (Microbial infection) Serves as an iron source for Neisseria species, which capture the protein and extract its iron for their own use.; FUNCTION: (Microbial infection) Serves as an iron source for parasite T.brucei (strain 427), which capture TF via its own transferrin receptor ESAG6:ESAG7 and extract its iron for its own use.
- Molecular Weight
- 77kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0338
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human