Antibodies
Anti-Transferrin Receptor Antibody-Oligo Conjugate (ARC54396)
SKU: aoc3672
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Transferrin Receptor Antibody (ARC54396)-IF1
Antibody Target
- Target
- Transferrin receptor protein 1
- UniProt Number
- P02786
- Target Description
- Cellular uptake of iron occurs via receptor-mediated endocytosis of ligand-occupied transferrin receptor into specialized endosomes. Endosomal acidification leads to iron release. The apotransferrin-receptor complex is then recycled to the cell surface with a return to neutral pH and the concomitant loss of affinity of apotransferrin for its receptor. Transferrin receptor is necessary for development of erythrocytes and the nervous system. A second ligand, the hereditary hemochromatosis protein HFE, competes for binding with transferrin for an overlapping C-terminal binding site. Positively regulates T and B cell proliferation through iron uptake. Acts as a lipid sensor that regulates mitochondrial fusion by regulating activation of the JNK pathway. When dietary levels of stearate (C18:0) are low, promotes activation of the JNK pathway, resulting in HUWE1-mediated ubiquitination and subsequent degradation of the mitofusin MFN2 and inhibition of mitochondrial fusion. When dietary levels of stearate (C18:0) are high, TFRC stearoylation inhibits activation of the JNK pathway and thus degradation of the mitofusin MFN2. Mediates uptake of NICOL1 into fibroblasts where it may regulate extracellular matrix production.; FUNCTION: (Microbial infection) Acts as a receptor for new-world arenaviruses: Guanarito, Junin and Machupo virus.; FUNCTION: (Microbial infection) Acts as a host entry factor for rabies virus that hijacks the endocytosis of TFRC to enter cells.; FUNCTION: (Microbial infection) Acts as a host entry factor for SARS-CoV, MERS-CoV and SARS-CoV-2 viruses that hijack the endocytosis of TFRC to enter cells.
- Molecular Weight
- 85kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC54396
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human