Antibodies
Anti-TRBP Antibody-Oligo Conjugate
SKU: aoc3677
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TRBP Antibody-IF1
Antibody Target
- Target
- RISC-loading complex subunit TARBP2
- UniProt Number
- Q15633
- Target Description
- Required for formation of the RNA induced silencing complex (RISC). Component of the RISC loading complex (RLC), also known as the micro-RNA (miRNA) loading complex (miRLC), which is composed of DICER1, AGO2 and TARBP2. Within the RLC/miRLC, DICER1 and TARBP2 are required to process precursor miRNAs (pre-miRNAs) to mature miRNAs and then load them onto AGO2. AGO2 bound to the mature miRNA constitutes the minimal RISC and may subsequently dissociate from DICER1 and TARBP2. May also play a role in the production of short interfering RNAs (siRNAs) from double-stranded RNA (dsRNA) by DICER1. Binds in vitro to the PRM1 3'-UTR. Seems to act as a repressor of translation. For some pre-miRNA substrates, may also alter the choice of cleavage site by DICER1. Negatively regulates IRF7-mediated IFN-beta signaling triggered by viral infection by inhibiting the phosphorylation of IRF7 and promoting its 'Lys'-48-linked ubiquitination and degradation.; FUNCTION: (Microbial infection) Binds to the HIV-1 TAR RNA which is located in the long terminal repeat (LTR) of HIV-1, and stimulates translation of TAR-containing RNAs. This is achieved in part at least by binding to and inhibiting EIF2AK2/PKR, thereby reducing phosphorylation and inhibition of EIF2S1/eIF-2-alpha. May also promote translation of TAR-containing RNAs independently of EIF2AK2/PKR. Mediates recruitment of FTSJ3 methyltransferase to HIV-1 RNA, leading to 2'-O-methylation of the viral genome, allowing HIV-1 to escape the innate immune system.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC1792
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat