Antibodies
Anti-TREX1 Antibody-Oligo Conjugate
SKU: aoc3678
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-TREX1 Antibody-PLA1
Antibody Target
- Target
- Three-prime repair exonuclease 1
- UniProt Number
- Q9NSU2
- Target Description
- Major cellular 3'-to-5' DNA exonuclease which digests single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with mismatched 3' termini. Prevents cell-intrinsic initiation of autoimmunity. Acts by metabolizing DNA fragments from endogenous retroelements, including L1, LTR and SINE elements. Plays a key role in degradation of DNA fragments at cytosolic micronuclei arising from genome instability: its association with the endoplasmic reticulum membrane directs TREX1 to ruptured micronuclei, leading to micronuclear DNA degradation. Micronuclear DNA degradation is required to limit CGAS activation and subsequent inflammation. Unless degraded, these DNA fragments accumulate in the cytosol and activate the cGAS-STING innate immune signaling, leading to the production of type I interferon. Prevents chronic ATM-dependent checkpoint activation, by processing ssDNA polynucleotide species arising from the processing of aberrant DNA replication intermediates. Inefficiently degrades oxidized DNA, such as that generated upon antimicrobial reactive oxygen production or upon absorption of UV light. During GZMA-mediated cell death, contributes to DNA damage in concert with NME1. NME1 nicks one strand of DNA and TREX1 removes bases from the free 3' end to enhance DNA damage and prevent DNA end reannealing and rapid repair.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0841
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human