Antibodies
Anti-TrkB Antibody-Oligo Conjugate
SKU: aoc3686
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TrkB Antibody-IF1
Antibody Target
- Target
- BDNF/NT-3 growth factors receptor
- UniProt Number
- Q16620
- Target Description
- Receptor tyrosine kinase involved in the development and the maturation of the central and the peripheral nervous systems through regulation of neuron survival, proliferation, migration, differentiation, and synapse formation and plasticity. Receptor for BDNF/brain-derived neurotrophic factor and NTF4/neurotrophin-4. Alternatively can also bind NTF3/neurotrophin-3 which is less efficient in activating the receptor but regulates neuron survival through NTRK2. Upon ligand-binding, undergoes homodimerization, autophosphorylation and activation. Recruits, phosphorylates and/or activates several downstream effectors including SHC1, FRS2, SH2B1, SH2B2 and PLCG1 that regulate distinct overlapping signaling cascades. Through SHC1, FRS2, SH2B1, SH2B2 activates the GRB2-Ras-MAPK cascade that regulates for instance neuronal differentiation including neurite outgrowth. Through the same effectors controls the Ras-PI3 kinase-AKT1 signaling cascade that mainly regulates growth and survival. Through PLCG1 and the downstream protein kinase C-regulated pathways controls synaptic plasticity. Thereby, plays a role in learning and memory by regulating both short term synaptic function and long-term potentiation. PLCG1 also leads to NF-Kappa-B activation and the transcription of genes involved in cell survival. Hence, it is able to suppress anoikis, the apoptosis resulting from loss of cell-matrix interactions. May also play a role in neutrophin-dependent calcium signaling in glial cells and mediate communication between neurons and glia.
- Molecular Weight
- 92kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53483
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat