Antibodies
Anti-Tryptophanyl-tRNA synthetase 1 Antibody-Oligo Conjugate (ARC2687)
SKU: aoc3700
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Tryptophanyl-tRNA synthetase 1 Antibody (ARC2687)-IF1
Antibody Target
- Target
- Tryptophan--tRNA ligase, cytoplasmic
- UniProt Number
- P23381
- Target Description
- Catalyzes the attachment of tryptophan to tRNA(Trp) in a two-step reaction: tryptophan is first activated by ATP to form Trp-AMP and then transferred to the acceptor end of the tRNA(Trp).; FUNCTION: [Isoform 1]: Has no angiostatic activity.; FUNCTION: [T2-TrpRS]: Possesses an angiostatic activity but has no aminoacylation activity. Inhibits fluid shear stress-activated responses of endothelial cells. Regulates ERK, Akt, and eNOS activation pathways that are associated with angiogenesis, cytoskeletal reorganization and shear stress-responsive gene expression.; FUNCTION: [Isoform 2]: Has an angiostatic activity.
- Molecular Weight
- 53kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2687
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human