Antibodies
Anti-TSLP Antibody-Oligo Conjugate
SKU: aoc3704
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TSLP Antibody-IF1
Antibody Target
- Target
- Thymic stromal lymphopoietin
- UniProt Number
- Q969D9
- Target Description
- [Isoform 1]: Cytokine that induces the release of T-cell-attracting chemokines from monocytes and, in particular, enhances the maturation of CD11c(+) dendritic cells. Can induce allergic inflammation by directly activating mast cells.; FUNCTION: [Isoform 2]: May act as an antimicrobial peptide in the oral cavity and on the skin.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC64624
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse