Antibodies
Anti-TTF1 Antibody-Oligo Conjugate (ARC1942)
SKU: aoc3707
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TTF1 Antibody (ARC1942)-IF1
Antibody Target
- Target
- Homeobox protein Nkx-2.1
- UniProt Number
- P43699
- Target Description
- Transcription factor that binds and activates the promoter of thyroid specific genes such as thyroglobulin, thyroperoxidase, and thyrotropin receptor. Crucial in the maintenance of the thyroid differentiation phenotype. May play a role in lung development and surfactant homeostasis. Forms a regulatory loop with GRHL2 that coordinates lung epithelial cell morphogenesis and differentiation. Activates the transcription of GNRHR and plays a role in enhancing the circadian oscillation of its gene expression. Represses the transcription of the circadian transcriptional repressor NR1D1.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1942
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat