Antibodies
Anti-TUBA1B Antibody-Oligo Conjugate
SKU: aoc1008
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TUBA1B Antibody-IF1
Antibody Target
- Target
- Tubulin alpha-1B chain
- UniProt Number
- P68363
- Target Description
- Tubulin is the major constituent of microtubules, protein filaments consisting of alpha- and beta-tubulin heterodimers (PubMed:38305685, PubMed:34996871, PubMed:38609661). Microtubules grow by the addition of GTP-tubulin dimers to the microtubule end, where a stabilizing cap forms (PubMed:38305685, PubMed:34996871, PubMed:38609661). Below the cap, tubulin dimers are in GDP-bound state, owing to GTPase activity of alpha-tubulin (PubMed:34996871, PubMed:38609661)..
- Molecular Weight
- 50 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC51243
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat