Antibodies
Anti-Tuberin Antibody-Oligo Conjugate
SKU: aoc3708
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Tuberin Antibody-PLA1
Antibody Target
- Target
- Tuberin
- UniProt Number
- P49815
- Target Description
- Catalytic component of the TSC-TBC complex, a multiprotein complex that acts as a negative regulator of the canonical mTORC1 complex, an evolutionarily conserved central nutrient sensor that stimulates anabolic reactions and macromolecule biosynthesis to promote cellular biomass generation and growth. Within the TSC-TBC complex, TSC2 acts as a GTPase-activating protein (GAP) for the small GTPase RHEB, a direct activator of the protein kinase activity of mTORC1. In absence of nutrients, the TSC-TBC complex inhibits mTORC1, thereby preventing phosphorylation of ribosomal protein S6 kinase (RPS6KB1 and RPS6KB2) and EIF4EBP1 (4E-BP1) by the mTORC1 signaling. The TSC-TBC complex is inactivated in response to nutrients, relieving inhibition of mTORC1. Involved in microtubule-mediated protein transport via its ability to regulate mTORC1 signaling. Also stimulates the intrinsic GTPase activity of the Ras-related proteins RAP1A and RAB5.
- Molecular Weight
- 201kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0019
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human