Antibodies
Anti-TWIST1 Antibody-Oligo Conjugate
SKU: aoc3712
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-TWIST1 Antibody-IF1
Antibody Target
- Target
- Twist-related protein 1
- UniProt Number
- Q15672
- Target Description
- Acts as a transcriptional regulator. Inhibits myogenesis by sequestrating E proteins, inhibiting trans-activation by MEF2, and inhibiting DNA-binding by MYOD1 through physical interaction. This interaction probably involves the basic domains of both proteins. Also represses expression of pro-inflammatory cytokines such as TNFA and IL1B. Regulates cranial suture patterning and fusion. Activates transcription as a heterodimer with E proteins. Regulates gene expression differentially, depending on dimer composition. Homodimers induce expression of FGFR2 and POSTN while heterodimers repress FGFR2 and POSTN expression and induce THBS1 expression. Heterodimerization is also required for osteoblast differentiation. Represses the activity of the circadian transcriptional activator: NPAS2-BMAL1 heterodimer.
- Molecular Weight
- 21kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC60803
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse