Antibodies
Anti-U1A Antibody-Oligo Conjugate
SKU: aoc3716
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-U1A Antibody-IF1
Antibody Target
- Target
- U1 small nuclear ribonucleoprotein A
- UniProt Number
- P09012
- Target Description
- Component of the spliceosomal U1 snRNP, which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. U1 snRNP is the first snRNP to interact with pre-mRNA. This interaction is required for the subsequent binding of U2 snRNP and the U4/U6/U5 tri-snRNP. SNRPA binds stem loop II of U1 snRNA. In a snRNP-free form (SF-A) may be involved in coupled pre-mRNA splicing and polyadenylation process. May bind preferentially to the 5'-UGCAC-3' motif on RNAs.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0823
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat