Antibodies
Anti-U2AF65 Antibody-Oligo Conjugate
SKU: aoc3717
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-U2AF65 Antibody-IF1
Antibody Target
- Target
- Splicing factor U2AF 65 kDa subunit
- UniProt Number
- P26368
- Target Description
- Plays a role in pre-mRNA splicing and 3'-end processing. By recruiting PRPF19 and the PRP19C/Prp19 complex/NTC/Nineteen complex to the RNA polymerase II C-terminal domain (CTD), and thereby pre-mRNA, may couple transcription to splicing. Induces cardiac troponin-T (TNNT2) pre-mRNA exon inclusion in muscle. Regulates the TNNT2 exon 5 inclusion through competition with MBNL1. Binds preferentially to a single-stranded structure within the polypyrimidine tract of TNNT2 intron 4 during spliceosome assembly. Required for the export of mRNA out of the nucleus, even if the mRNA is encoded by an intron-less gene. Represses the splicing of MAPT/Tau exon 10. Positively regulates pre-mRNA 3'-end processing by recruiting the CFIm complex to cleavage and polyadenylation signals.
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC1029
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat