Antibodies
Anti-UAP56 Antibody-Oligo Conjugate
SKU: aoc3719
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UAP56 Antibody-IF1
Antibody Target
- Target
- Spliceosome RNA helicase DDX39B
- UniProt Number
- Q13838
- Target Description
- Involved in nuclear export of spliced and unspliced mRNA. Component of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and specifically associates with spliced mRNA and not with unspliced pre-mRNA. The TREX complex is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NXF1 pathway. The THOC1-THOC2-THOC3 core complex alone is sufficient to promote ATPase activity of DDX39B; in the complex THOC2 is the only component that directly interacts with DDX39B. Associates with SARNP/CIP29, which facilitates RNA binding of DDX39B and likely plays a role in mRNA export. May undergo several rounds of ATP hydrolysis during assembly of TREX to drive subsequent loading of components such as ALYREF/THOC4 and CHTOP onto mRNA. Also associates with pre-mRNA independent of ALYREF/THOC4. Involved in the nuclear export of intronless mRNA; the ATP-bound form is proposed to recruit export adapter ALYREF/THOC4 to intronless mRNA; its ATPase activity is cooperatively stimulated by RNA and ALYREF/THOC4 and ATP hydrolysis is thought to trigger the dissociation from RNA to allow the association of ALYREF/THOC4 and the NXF1-NXT1 heterodimer. Involved in transcription elongation and genome stability.; FUNCTION: Splice factor that is required for the first ATP-dependent step in spliceosome assembly and for the interaction of U2 snRNP with the branchpoint. Has both RNA-stimulated ATP binding/hydrolysis activity and ATP-dependent RNA unwinding activity. Even with the stimulation of RNA, the ATPase activity is weak. Can only hydrolyze ATP but not other NTPs. The RNA stimulation of ATPase activity does not have a strong preference for the sequence and length of the RNA. However, ssRNA stimulates the ATPase activity much more strongly than dsRNA. Can unwind 5' or 3' overhangs or blunt end RNA duplexes in vitro. The ATPase and helicase activities are not influenced by U2AF2; the effect of ALYREF/THOC4 is reported conflictingly with [PubMed:23299939] reporting a stimulatory effect.; FUNCTION: (Microbial infection) The TREX complex is essential for the export of Kaposi's sarcoma-associated herpesvirus (KSHV) intronless mRNAs and infectious virus production.
- Molecular Weight
- 49kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1731
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat