Antibodies
Anti-UBA1 Antibody-Oligo Conjugate
SKU: aoc3720
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UBA1 Antibody-IF1
Antibody Target
- Target
- Ubiquitin-like modifier-activating enzyme 1
- UniProt Number
- P22314
- Target Description
- Catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation through the ubiquitin-proteasome system. Activates ubiquitin by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding a ubiquitin-E1 thioester and free AMP. Essential for the formation of radiation-induced foci, timely DNA repair and for response to replication stress. Promotes the recruitment of TP53BP1 and BRCA1 at DNA damage sites.
- Molecular Weight
- 118kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1493
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat