Antibodies
Anti-UBC13 Antibody-Oligo Conjugate
SKU: aoc3723
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UBC13 Antibody-IF1
Antibody Target
- Target
- Ubiquitin-conjugating enzyme E2 N
- UniProt Number
- P61088
- Target Description
- The UBE2V1-UBE2N and UBE2V2-UBE2N heterodimers catalyze the synthesis of non-canonical 'Lys-63'-linked polyubiquitin chains. This type of polyubiquitination does not lead to protein degradation by the proteasome. Mediates transcriptional activation of target genes. Plays a role in the control of progress through the cell cycle and differentiation. Plays a role in the error-free DNA repair pathway and contributes to the survival of cells after DNA damage. Acts together with the E3 ligases, HLTF and SHPRH, in the 'Lys-63'-linked poly-ubiquitination of PCNA upon genotoxic stress, which is required for DNA repair. Appears to act together with E3 ligase RNF5 in the 'Lys-63'-linked polyubiquitination of JKAMP thereby regulating JKAMP function by decreasing its association with components of the proteasome and ERAD. Promotes TRIM5 capsid-specific restriction activity and the UBE2V1-UBE2N heterodimer acts in concert with TRIM5 to generate 'Lys-63'-linked polyubiquitin chains which activate the MAP3K7/TAK1 complex which in turn results in the induction and expression of NF-kappa-B and MAPK-responsive inflammatory genes. Together with RNF135 and UB2V1, catalyzes the viral RNA-dependent 'Lys-63'-linked polyubiquitination of RIGI to activate the downstream signaling pathway that leads to interferon beta production. UBE2V1-UBE2N together with TRAF3IP2 E3 ubiquitin ligase mediate 'Lys-63'-linked polyubiquitination of TRAF6, a component of IL17A-mediated signaling pathway.
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1495
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat