Antibodies
Anti-UBC9 Antibody-Oligo Conjugate
SKU: aoc3724
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UBC9 Antibody-IF1
Antibody Target
- Target
- SUMO-conjugating enzyme UBC9
- UniProt Number
- P63279
- Target Description
- Accepts the ubiquitin-like proteins SUMO1, SUMO2, SUMO3, SUMO4 and SUMO1P1/SUMO5 from the UBLE1A-UBLE1B E1 complex and catalyzes their covalent attachment to other proteins with the help of an E3 ligase such as RANBP2, CBX4 and ZNF451. Can catalyze the formation of poly-SUMO chains. Necessary for sumoylation of FOXL2 and KAT5. Essential for nuclear architecture and chromosome segregation. Sumoylates p53/TP53 at 'Lys-386'. Mediates sumoylation of ERCC6 which is essential for its transcription-coupled nucleotide excision repair activity.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0996
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat