Antibodies
Anti-UBE2B Antibody-Oligo Conjugate
SKU: aoc3726
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UBE2B Antibody-IF1
Antibody Target
- Target
- Ubiquitin-conjugating enzyme E2 B
- UniProt Number
- P63146
- Target Description
- E2 ubiquitin-conjugating enzyme that accepts ubiquitin from the ubiquitin-activating enzyme E1 and transfers it to a E3 ubiquitin-protein ligase. In vitro catalyzes 'Lys-11'-, as well as 'Lys-48'- and 'Lys-63'-linked polyubiquitination. Together with the E3 enzyme BRE1 (RNF20 and/or RNF40), plays a role in transcription regulation by catalyzing the monoubiquitination of histone H2B at 'Lys-120' to form H2BK120ub1. H2BK120ub1 gives a specific tag for epigenetic transcriptional activation, elongation by RNA polymerase II, telomeric silencing, and is also a prerequisite for H3K4me and H3K79me formation. May play a role in DNA repair. Associates to the E3 ligase RAD18 to form the UBE2B-RAD18 ubiquitin ligase complex involved in mono-ubiquitination of DNA-associated PCNA on 'Lys-164'. In association with the E3 enzyme UBR4, is involved in N-end rule-dependent protein degradation. May be involved in neurite outgrowth.
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2512
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat