Antibodies
Anti-UBE2C Antibody-Oligo Conjugate
SKU: aoc3727
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UBE2C Antibody-IF1
Antibody Target
- Target
- Ubiquitin-conjugating enzyme E2 C
- UniProt Number
- O00762
- Target Description
- Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys-11'- and 'Lys-48'-linked polyubiquitination. Acts as an essential factor of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis. Acts by initiating 'Lys-11'-linked polyubiquitin chains on APC/C substrates, leading to the degradation of APC/C substrates by the proteasome and promoting mitotic exit.
- Molecular Weight
- 20kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC62956
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat