Antibodies
Anti-UBE2L3 Antibody-Oligo Conjugate
SKU: aoc3728
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UBE2L3 Antibody-IF1
Antibody Target
- Target
- Ubiquitin-conjugating enzyme E2 L3
- UniProt Number
- P68036
- Target Description
- Ubiquitin-conjugating enzyme E2 that specifically acts with HECT-type and RBR family E3 ubiquitin-protein ligases. Does not function with most RING-containing E3 ubiquitin-protein ligases because it lacks intrinsic E3-independent reactivity with lysine; in contrast, it has activity with the RBR family E3 enzymes, such as PRKN, RNF31 and ARIH1, that function like RING-HECT hybrids. Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Mediates ubiquitination by the CUL9-RBX1 complex. In vitro catalyzes 'Lys-11'-linked polyubiquitination. Involved in the selective degradation of short-lived and abnormal proteins. Down-regulated during the S-phase it is involved in progression through the cell cycle. Regulates nuclear hormone receptors transcriptional activity. May play a role in myelopoiesis.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2836
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat