Antibodies
Anti-UCHL3 Antibody-Oligo Conjugate
SKU: aoc3735
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UCHL3 Antibody-IF1
Antibody Target
- Target
- Ubiquitin carboxyl-terminal hydrolase isozyme L3
- UniProt Number
- P15374
- Target Description
- Deubiquitinating enzyme (DUB) that controls levels of cellular ubiquitin through processing of ubiquitin precursors and ubiquitinated proteins. Thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of either ubiquitin or NEDD8. Has a 10-fold preference for Arg and Lys at position P3'', and exhibits a preference towards 'Lys-48'-linked ubiquitin chains. Deubiquitinates ENAC in apical compartments, thereby regulating apical membrane recycling. Indirectly increases the phosphorylation of IGFIR, AKT and FOXO1 and promotes insulin-signaling and insulin-induced adipogenesis. Required for stress-response retinal, skeletal muscle and germ cell maintenance. May be involved in working memory. Can hydrolyze UBB(+1), a mutated form of ubiquitin which is not effectively degraded by the proteasome and is associated with neurogenerative disorders.
- Molecular Weight
- 26kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1874
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat