Antibodies
Anti-UHRF1 Antibody-Oligo Conjugate
SKU: aoc3743
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UHRF1 Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase UHRF1
- UniProt Number
- Q96T88
- Target Description
- Multidomain protein that acts as a key epigenetic regulator by bridging DNA methylation and chromatin modification. Specifically recognizes and binds hemimethylated DNA at replication forks via its YDG domain and recruits DNMT1 methyltransferase to ensure faithful propagation of the DNA methylation patterns through DNA replication. In addition to its role in maintenance of DNA methylation, also plays a key role in chromatin modification: through its tudor-like regions and PHD-type zinc fingers, specifically recognizes and binds histone H3 trimethylated at 'Lys-9' (H3K9me3) and unmethylated at 'Arg-2' (H3R2me0), respectively, and recruits chromatin proteins. Enriched in pericentric heterochromatin where it recruits different chromatin modifiers required for this chromatin replication. Also localizes to euchromatic regions where it negatively regulates transcription possibly by impacting DNA methylation and histone modifications. Has E3 ubiquitin-protein ligase activity by mediating the ubiquitination of target proteins such as histone H3 and PML. It is still unclear how E3 ubiquitin-protein ligase activity is related to its role in chromatin in vivo. Plays a role in DNA repair by cooperating with UHRF2 to ensure recruitment of FANCD2 to interstrand cross-links (ICLs) leading to FANCD2 activation. Acts as a critical player of proper spindle architecture by catalyzing the 'Lys-63'-linked ubiquitination of KIF11, thereby controlling KIF11 localization on the spindle.
- Molecular Weight
- 90kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC74569
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat