Antibodies
Anti-ULK3 Antibody-Oligo Conjugate
SKU: aoc3746
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-ULK3 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase ULK3
- UniProt Number
- Q6PHR2
- Target Description
- Serine/threonine protein kinase that acts as a regulator of Sonic hedgehog (SHH) signaling and autophagy. Acts as a negative regulator of SHH signaling in the absence of SHH ligand: interacts with SUFU, thereby inactivating the protein kinase activity and preventing phosphorylation of GLI proteins (GLI1, GLI2 and/or GLI3). Positively regulates SHH signaling in the presence of SHH: dissociates from SUFU, autophosphorylates and mediates phosphorylation of GLI2, activating it and promoting its nuclear translocation. Phosphorylates in vitro GLI2, as well as GLI1 and GLI3, although less efficiently. Also acts as a regulator of autophagy: following cellular senescence, able to induce autophagy.
- Molecular Weight
- 53kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2118
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse