Antibodies
Anti-UPF1 Antibody-Oligo Conjugate
SKU: aoc3747
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UPF1 Antibody-IF1
Antibody Target
- Target
- Regulator of nonsense transcripts 1
- UniProt Number
- Q92900
- Target Description
- RNA-dependent helicase required for nonsense-mediated decay (NMD) of aberrant mRNAs containing premature stop codons and modulates the expression level of normal mRNAs. Is recruited to mRNAs upon translation termination and undergoes a cycle of phosphorylation and dephosphorylation; its phosphorylation appears to be a key step in NMD. Recruited by release factors to stalled ribosomes together with the SMG1C protein kinase complex to form the transient SURF (SMG1-UPF1-eRF1-eRF3) complex. In EJC-dependent NMD, the SURF complex associates with the exon junction complex (EJC) (located 50-55 or more nucleotides downstream from the termination codon) through UPF2 and allows the formation of an UPF1-UPF2-UPF3 surveillance complex which is believed to activate NMD. Phosphorylated UPF1 is recognized by EST1B/SMG5, SMG6 and SMG7 which are thought to provide a link to the mRNA degradation machinery involving exonucleolytic and endonucleolytic pathways, and to serve as adapters to protein phosphatase 2A (PP2A), thereby triggering UPF1 dephosphorylation and allowing the recycling of NMD factors. UPF1 can also activate NMD without UPF2 or UPF3, and in the absence of the NMD-enhancing downstream EJC indicative for alternative NMD pathways. Plays a role in replication-dependent histone mRNA degradation at the end of phase S; the function is independent of UPF2. For the recognition of premature termination codons (PTC) and initiation of NMD a competitive interaction between UPF1 and PABPC1 with the ribosome-bound release factors is proposed. The ATPase activity of UPF1 is required for disassembly of mRNPs undergoing NMD. Together with UPF2 and dependent on TDRD6, mediates the degradation of mRNA harboring long 3'UTR by inducing the NMD machinery. Also capable of unwinding double-stranded DNA and translocating on single-stranded DNA.
- Molecular Weight
- 124kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC1268
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat