Antibodies
Anti-UQCRC2 Antibody-Oligo Conjugate
SKU: aoc3750
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UQCRC2 Antibody-IF1
Antibody Target
- Target
- Cytochrome b-c1 complex subunit 2, mitochondrial
- UniProt Number
- P22695
- Target Description
- Component of the ubiquinol-cytochrome c oxidoreductase, a multisubunit transmembrane complex that is part of the mitochondrial electron transport chain which drives oxidative phosphorylation. The respiratory chain contains 3 multisubunit complexes succinate dehydrogenase (complex II, CII), ubiquinol-cytochrome c oxidoreductase (cytochrome b-c1 complex, complex III, CIII) and cytochrome c oxidase (complex IV, CIV), that cooperate to transfer electrons derived from NADH and succinate to molecular oxygen, creating an electrochemical gradient over the inner membrane that drives transmembrane transport and the ATP synthase. The cytochrome b-c1 complex catalyzes electron transfer from ubiquinol to cytochrome c, linking this redox reaction to translocation of protons across the mitochondrial inner membrane, with protons being carried across the membrane as hydrogens on the quinol. In the process called Q cycle, 2 protons are consumed from the matrix, 4 protons are released into the intermembrane space and 2 electrons are passed to cytochrome c. The 2 core subunits UQCRC1/QCR1 and UQCRC2/QCR2 are homologous to the 2 mitochondrial-processing peptidase (MPP) subunits beta-MPP and alpha-MPP respectively, and they seem to have preserved their MPP processing properties. May be involved in the in situ processing of UQCRFS1 into the mature Rieske protein and its mitochondrial targeting sequence (MTS)/subunit 9 when incorporated into complex III (Probable).
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0982
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat