Antibodies
Anti-Uromodulin Antibody-Oligo Conjugate
SKU: aoc3753
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Uromodulin Antibody-IF1
Antibody Target
- Target
- Uromodulin
- UniProt Number
- P07911
- Target Description
- [Uromodulin]: Functions in biogenesis and organization of the apical membrane of epithelial cells of the thick ascending limb of Henle's loop (TALH), where it promotes formation of complex filamentous gel-like structure that may play a role in the water barrier permeability (Probable). May serve as a receptor for binding and endocytosis of cytokines (IL-1, IL-2) and TNF. Facilitates neutrophil migration across renal epithelia.; FUNCTION: [Uromodulin, secreted form]: In the urine, may contribute to colloid osmotic pressure, retards passage of positively charged electrolytes, and inhibits formation of liquid containing supersaturated salts and subsequent formation of salt crystals. Protects against urinary tract infections by binding to type 1 fimbriated E.coli. Binds to bacterial adhesin fimH which mediates the stable formation of bacterial aggregates, prevents the binding of E.coli to uroplakins UPK1A and UPK1B which act as urothelial receptors for type I fimbriae, and allows for pathogen clearance through micturation. Also promotes aggregation of other bacteria including K.pneumoniae, P.aeruginosa and S.mitis and so may also protect against other uropathogens.
- Molecular Weight
- 70kDa/55kDa/115kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC60861
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse