Antibodies
Anti-USP10 Antibody-Oligo Conjugate
SKU: aoc3757
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-USP10 Antibody-IF1
Antibody Target
- Target
- Ubiquitin carboxyl-terminal hydrolase 10
- UniProt Number
- Q14694
- Target Description
- Hydrolase that can remove conjugated ubiquitin from target proteins such as p53/TP53, RPS2/us5, RPS3/us3, RPS10/eS10, BECN1, SNX3 and CFTR. Acts as an essential regulator of p53/TP53 stability: in unstressed cells, specifically deubiquitinates p53/TP53 in the cytoplasm, leading to counteract MDM2 action and stabilize p53/TP53. Following DNA damage, translocates to the nucleus and deubiquitinates p53/TP53, leading to regulate the p53/TP53-dependent DNA damage response. Component of a regulatory loop that controls autophagy and p53/TP53 levels: mediates deubiquitination of BECN1, a key regulator of autophagy, leading to stabilize the PIK3C3/VPS34-containing complexes. In turn, PIK3C3/VPS34-containing complexes regulate USP10 stability, suggesting the existence of a regulatory system by which PIK3C3/VPS34-containing complexes regulate p53/TP53 protein levels via USP10 and USP13. Does not deubiquitinate MDM2. Plays a key role in 40S ribosome subunit recycling when a ribosome has stalled during translation: acts both by inhibiting formation of stress granules, which store stalled translation pre-initiation complexes, and mediating deubiquitination of 40S ribosome subunits. Acts as a negative regulator of stress granules formation by lowering G3BP1 and G3BP2 valence, thereby preventing G3BP1 and G3BP2 ability to undergo liquid-liquid phase separation (LLPS) and assembly of stress granules. Promotes 40S ribosome subunit recycling following ribosome dissociation in response to ribosome stalling by mediating deubiquitination of 40S ribosomal proteins RPS2/us5, RPS3/us3 and RPS10/eS10, thereby preventing their degradation by the proteasome. Part of a ribosome quality control that takes place when ribosomes have stalled during translation initiation (iRQC): USP10 acts by removing monoubiquitination of RPS2/us5 and RPS3/us3, promoting 40S ribosomal subunit recycling. Deubiquitinates CFTR in early endosomes, enhancing its endocytic recycling. Involved in a TANK-dependent negative feedback response to attenuate NF-kappa-B activation via deubiquitinating IKBKG or TRAF6 in response to interleukin-1-beta (IL1B) stimulation or upon DNA damage. Deubiquitinates TBX21 leading to its stabilization. Plays a negative role in the RLR signaling pathway upon RNA virus infection by blocking the RIGI-mediated MAVS activation. Mechanistically, removes the unanchored 'Lys-63'-linked polyubiquitin chains of MAVS to inhibit its aggregation, essential for its activation.
- Molecular Weight
- 87kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1015
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse