Antibodies

Anti-USP10 Antibody-Oligo Conjugate

SKU: aoc3757

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-USP10 Antibody-IF1

Antibody Target

Target
Ubiquitin carboxyl-terminal hydrolase 10
UniProt Number
Q14694
Target Description
Hydrolase that can remove conjugated ubiquitin from target proteins such as p53/TP53, RPS2/us5, RPS3/us3, RPS10/eS10, BECN1, SNX3 and CFTR. Acts as an essential regulator of p53/TP53 stability: in unstressed cells, specifically deubiquitinates p53/TP53 in the cytoplasm, leading to counteract MDM2 action and stabilize p53/TP53. Following DNA damage, translocates to the nucleus and deubiquitinates p53/TP53, leading to regulate the p53/TP53-dependent DNA damage response. Component of a regulatory loop that controls autophagy and p53/TP53 levels: mediates deubiquitination of BECN1, a key regulator of autophagy, leading to stabilize the PIK3C3/VPS34-containing complexes. In turn, PIK3C3/VPS34-containing complexes regulate USP10 stability, suggesting the existence of a regulatory system by which PIK3C3/VPS34-containing complexes regulate p53/TP53 protein levels via USP10 and USP13. Does not deubiquitinate MDM2. Plays a key role in 40S ribosome subunit recycling when a ribosome has stalled during translation: acts both by inhibiting formation of stress granules, which store stalled translation pre-initiation complexes, and mediating deubiquitination of 40S ribosome subunits. Acts as a negative regulator of stress granules formation by lowering G3BP1 and G3BP2 valence, thereby preventing G3BP1 and G3BP2 ability to undergo liquid-liquid phase separation (LLPS) and assembly of stress granules. Promotes 40S ribosome subunit recycling following ribosome dissociation in response to ribosome stalling by mediating deubiquitination of 40S ribosomal proteins RPS2/us5, RPS3/us3 and RPS10/eS10, thereby preventing their degradation by the proteasome. Part of a ribosome quality control that takes place when ribosomes have stalled during translation initiation (iRQC): USP10 acts by removing monoubiquitination of RPS2/us5 and RPS3/us3, promoting 40S ribosomal subunit recycling. Deubiquitinates CFTR in early endosomes, enhancing its endocytic recycling. Involved in a TANK-dependent negative feedback response to attenuate NF-kappa-B activation via deubiquitinating IKBKG or TRAF6 in response to interleukin-1-beta (IL1B) stimulation or upon DNA damage. Deubiquitinates TBX21 leading to its stabilization. Plays a negative role in the RLR signaling pathway upon RNA virus infection by blocking the RIGI-mediated MAVS activation. Mechanistically, removes the unanchored 'Lys-63'-linked polyubiquitin chains of MAVS to inhibit its aggregation, essential for its activation.
Molecular Weight
87kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCELISA
Clone
ARC1015
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouse