Antibodies
Anti-USP14 Antibody-Oligo Conjugate
SKU: aoc3759
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-USP14 Antibody-PLA1
Antibody Target
- Target
- Ubiquitin carboxyl-terminal hydrolase 14
- UniProt Number
- P54578
- Target Description
- Proteasome-associated deubiquitinase which releases ubiquitin from the proteasome targeted ubiquitinated proteins. Ensures the regeneration of ubiquitin at the proteasome. Is a reversibly associated subunit of the proteasome and a large fraction of proteasome-free protein exists within the cell. Required for the degradation of the chemokine receptor CXCR4 which is critical for CXCL12-induced cell chemotaxis. Also serves as a physiological inhibitor of endoplasmic reticulum-associated degradation (ERAD) under the non-stressed condition by inhibiting the degradation of unfolded endoplasmic reticulum proteins via interaction with ERN1. Indispensable for synaptic development and function at neuromuscular junctions (NMJs). Plays a role in the innate immune defense against viruses by stabilizing the viral DNA sensor CGAS and thus inhibiting its autophagic degradation. Inhibits OPTN-mediated selective autophagic degradation of KDM4D and thereby negatively regulates H3K9me2 and H3K9me3.
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC2185
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat