Antibodies
Anti-USP25 Antibody-Oligo Conjugate
SKU: aoc3762
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-USP25 Antibody-IF1
Antibody Target
- Target
- Ubiquitin carboxyl-terminal hydrolase 25
- UniProt Number
- Q9UHP3
- Target Description
- Deubiquitinating enzyme that hydrolyzes ubiquitin moieties conjugated to substrates and thus, functions in various biological processes including inflammation and immune response. Modulates the Wnt/beta-catenin pathway by deubiquitinating and stabilizing tankyrases TNKS1 and TNKS2. Regulates KEAP1-NRF2 axis in the defense against oxidative assaults by deubiquitinating KEAP1 and protecting it from degradation leading to degradation of the NRF2 transcription factor that is responsible for mounting an anti-oxidation gene expression program. Positively regulates RNA virus-induced innate signaling by interacting with and deubiquitinating ERLIN1 and ERLIN2. In turn, restricts virus production by regulating cholesterol biosynthetic flux. Acts as a negative regulator of interleukin-17-mediated signaling and inflammation through the removal of 'Lys-63'-linked ubiquitination of TRAF5 and TRAF6. Prevents the ubiquitination and degradation of TRAF3 to reduce the phosphorylation levels of JNK and P38, the secretion of IL-1B and to induce endotoxin tolerance.; FUNCTION: The muscle-specific isoform (USP25m) may have a role in the regulation of muscular differentiation and function.
- Molecular Weight
- 122KDa/125KDa/129KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC60125
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat