Antibodies
Anti-USP39 Antibody-Oligo Conjugate (ARC2565)
SKU: aoc3763
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-USP39 Antibody (ARC2565)-IF1
Antibody Target
- Target
- Ubiquitin carboxyl-terminal hydrolase 39
- UniProt Number
- Q53GS9
- Target Description
- Deubiquitinating enzyme that plays a role in many cellular processes including cellular antiviral response, epithelial morphogenesis, DNA repair or B-cell development. Plays a role in pre-mRNA splicing as a component of the U4/U6-U5 tri-snRNP, one of the building blocks of the precatalytic spliceosome. Specifically regulates immunoglobulin gene rearrangement in a spliceosome-dependent manner, which involves modulating chromatin interactions at the Igh locus and therefore plays an essential role in B-cell development. Regulates AURKB mRNA levels, and thereby plays a role in cytokinesis and in the spindle checkpoint. Regulates apoptosis and G2/M cell cycle checkpoint in response to DNA damage by deubiquitinating and stabilizing CHK2. Also plays an important role in DNA repair by controlling the recruitment of XRCC4/LIG4 to DNA double-strand breaks for non-homologous end-joining repair. Participates in antiviral activity by affecting the type I IFN signaling by stabilizing STAT1 and decreasing its 'Lys-6'-linked ubiquitination. Contributes to non-canonical Wnt signaling during epidermal differentiation. Acts as a negative regulator NF-kappa-B activation through deubiquitination of 'Lys-48'-linked ubiquitination of NFKBIA.
- Molecular Weight
- 65kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2565
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat