Antibodies

Anti-USP7/HAUSP Antibody-Oligo Conjugate

SKU: aoc3765

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-USP7/HAUSP Antibody-IF1

Antibody Target

Target
Ubiquitin carboxyl-terminal hydrolase 7
UniProt Number
Q93009
Target Description
Hydrolase that deubiquitinates target proteins such as ARMC5, FOXO4, DEPTOR, KAT5, p53/TP53, MDM2, ERCC6, DNMT1, UHRF1, PTEN, KMT2E/MLL5 and DAXX. Together with DAXX, prevents MDM2 self-ubiquitination and enhances the E3 ligase activity of MDM2 towards p53/TP53, thereby promoting p53/TP53 ubiquitination and proteasomal degradation. Deubiquitinates p53/TP53, preventing degradation of p53/TP53, and enhances p53/TP53-dependent transcription regulation, cell growth repression and apoptosis. Deubiquitinates p53/TP53 and MDM2 and strongly stabilizes p53/TP53 even in the presence of excess MDM2, and also induces p53/TP53-dependent cell growth repression and apoptosis. Deubiquitination of FOXO4 in presence of hydrogen peroxide is not dependent on p53/TP53 and inhibits FOXO4-induced transcriptional activity. In association with DAXX, is involved in the deubiquitination and translocation of PTEN from the nucleus to the cytoplasm, both processes that are counteracted by PML. Deubiquitinates KMT2E/MLL5 preventing KMT2E/MLL5 proteasomal-mediated degradation. Involved in cell proliferation during early embryonic development. Involved in transcription-coupled nucleotide excision repair (TC-NER) in response to UV damage: recruited to DNA damage sites following interaction with KIAA1530/UVSSA and promotes deubiquitination of ERCC6, preventing UV-induced degradation of ERCC6. Involved in maintenance of DNA methylation via its interaction with UHRF1 and DNMT1: acts by mediating deubiquitination of UHRF1 and DNMT1, preventing their degradation and promoting DNA methylation by DNMT1. Deubiquitinates alkylation repair enzyme ALKBH3. OTUD4 recruits USP7 and USP9X to stabilize ALKBH3, thereby promoting the repair of alkylated DNA lesions. Acts as a chromatin regulator via its association with the Polycomb group (PcG) multiprotein PRC1-like complex; may act by deubiquitinating components of the PRC1-like complex. Able to mediate deubiquitination of histone H2B; it is however unsure whether this activity takes place in vivo. Exhibits a preference towards 'Lys-48'-linked ubiquitin chains. Increases regulatory T-cells (Treg) suppressive capacity by deubiquitinating and stabilizing the transcription factor FOXP3 which is crucial for Treg cell function. Plays a role in the maintenance of the circadian clock periodicity via deubiquitination and stabilization of the CRY1 and CRY2 proteins. Deubiquitinates REST, thereby stabilizing REST and promoting the maintenance of neural progenitor cells. Deubiquitinates SIRT7, inhibiting SIRT7 histone deacetylase activity and regulating gluconeogenesis. Involved in the regulation of WASH-dependent actin polymerization at the surface of endosomes and the regulation of endosomal protein recycling. It maintains optimal WASH complex activity and precise F-actin levels via deubiquitination of TRIM27 and WASHC1. Mediates the deubiquitination of phosphorylated DEPTOR, promoting its stability and leading to decreased mTORC1 signaling.; FUNCTION: (Microbial infection) Contributes to the overall stabilization and trans-activation capability of the herpesvirus 1 trans-acting transcriptional protein ICP0/VMW110 during HSV-1 infection.; FUNCTION: (Microbial infection) Upon infection with Epstein-Barr virus, the interaction with viral EBNA1 increases the association of USP7 with PML proteins, which is required for the polyubiquitylation and degradation of PML.
Molecular Weight
128kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0777
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat