Antibodies
Anti-USP9X Antibody-Oligo Conjugate
SKU: aoc3766
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-USP9X Antibody-IF1
Antibody Target
- Target
- Ubiquitin carboxyl-terminal hydrolase 9X
- UniProt Number
- Q93008
- Target Description
- Deubiquitinase involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. May therefore play an important regulatory role at the level of protein turnover by preventing degradation of proteins through the removal of conjugated ubiquitin. Specifically hydrolyzes 'Lys-11'-, followed by 'Lys-63'-, 'Lys-48'- and 'Lys-6'-linked polyubiquitins chains. Essential component of TGF-beta/BMP signaling cascade. Specifically deubiquitinates monoubiquitinated SMAD4, opposing the activity of E3 ubiquitin-protein ligase TRIM33. Deubiquitinates alkylation repair enzyme ALKBH3. OTUD4 recruits USP7 and USP9X to stabilize ALKBH3, thereby promoting the repair of alkylated DNA lesions. Deubiquitinates RNA demethylase enzyme ALKBH5, promoting its stability. Deubiquitinates mTORC2 complex component RICTOR at 'Lys-294' by removing 'Lys-63'-linked polyubiquitin chains, stabilizing RICTOR and enhancing its binding to MTOR, thus promoting mTORC2 complex assembly. Regulates chromosome alignment and segregation in mitosis by regulating the localization of BIRC5/survivin to mitotic centromeres. Involved in axonal growth and neuronal cell migration. Regulates cellular clock function by enhancing the protein stability and transcriptional activity of the core circadian protein BMAL1 via its deubiquitinating activity. Acts as a regulator of peroxisome import by mediating deubiquitination of PEX5: specifically deubiquitinates PEX5 monoubiquitinated at 'Cys-11' following its retrotranslocation into the cytosol, resetting PEX5 for a subsequent import cycle. Deubiquitinates PEG10. Inhibits the activation of the Hippo signaling pathway via deubiquitination of AMOTL2 at 'Lys-347' and 'Lys-408' which prohibits its interaction with and activation of LATS2. Loss of LATS2 activation and subsequent loss of YAP1 phosphorylation results in an increase in YAP1-driven transcription of target genes.
- Molecular Weight
- 290kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1748
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat