Antibodies
Anti-UTX Antibody-Oligo Conjugate
SKU: aoc3767
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-UTX Antibody-IF1
Antibody Target
- Target
- Lysine-specific demethylase 6A
- UniProt Number
- O15550
- Target Description
- Histone demethylase that specifically demethylates 'Lys-27' of histone H3, thereby playing a central role in histone code. Demethylates trimethylated and dimethylated but not monomethylated H3 'Lys-27'. Plays a central role in regulation of posterior development, by regulating HOX gene expression. Demethylation of 'Lys-27' of histone H3 is concomitant with methylation of 'Lys-4' of histone H3, and regulates the recruitment of the PRC1 complex and monoubiquitination of histone H2A. Plays a demethylase-independent role in chromatin remodeling to regulate T-box family member-dependent gene expression.
- Molecular Weight
- 154kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC71730
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat