Antibodies
Anti-VAMP8 Antibody-Oligo Conjugate
SKU: aoc3770
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VAMP8 Antibody-IF1
Antibody Target
- Target
- Vesicle-associated membrane protein 8
- UniProt Number
- Q9BV40
- Target Description
- SNAREs, soluble N-ethylmaleimide-sensitive factor-attachment protein receptors, are essential proteins for fusion of cellular membranes. SNAREs localized on opposing membranes assemble to form a trans-SNARE complex, an extended, parallel four alpha-helical bundle that drives membrane fusion. VAMP8 is a SNARE involved in autophagy through the direct control of autophagosome membrane fusion with the lysososome membrane via its interaction with the STX17-SNAP29 binary t-SNARE complex. Also required for dense-granule secretion in platelets. Also plays a role in regulated enzyme secretion in pancreatic acinar cells. Involved in the abscission of the midbody during cell division, which leads to completely separate daughter cells. Involved in the homotypic fusion of early and late endosomes. Also participates in the activation of type I interferon antiviral response through a TRIM6-dependent mechanism.
- Molecular Weight
- 11kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1108
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat