Antibodies
Anti-VDAC2 Antibody-Oligo Conjugate
SKU: aoc3776
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VDAC2 Antibody-IF1
Antibody Target
- Target
- Non-selective voltage-gated ion channel VDAC2
- UniProt Number
- P45880
- Target Description
- Non-selective voltage-gated ion channel that mediates the transport of anions and cations through the mitochondrion outer membrane and plasma membrane. The channel adopts an open conformation at zero mV and a closed conformation at both positive and negative potentials. There are two populations of channels; the main that functions in a lower open-state conductance with lower ion selectivity, that switch, in a voltage-dependent manner, from the open to a low-conducting 'closed' state and the other that has a normal ion selectivity in the typical high conductance, 'open' state. Binds various lipids, including the sphingolipid ceramide, the phospholipid phosphatidylcholine, and the sterols cholesterol and oxysterol. Binding of ceramide promotes the mitochondrial outer membrane permeabilization (MOMP) apoptotic pathway.; FUNCTION: Catalyzes the scrambling of phospholipids across the outer mitochondrial membrane; the mechanism is unrelated to channel activity and is capable of translocating both anionic and zwitterionic phospholipids.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53370
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat