Antibodies
Anti-VDR Antibody-Oligo Conjugate
SKU: aoc3777
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VDR Antibody-IF1
Antibody Target
- Target
- Vitamin D3 receptor
- UniProt Number
- P11473
- Target Description
- Nuclear receptor for calcitriol, the active form of vitamin D3 which mediates the action of this vitamin on cells. Enters the nucleus upon vitamin D3 binding where it forms heterodimers with the retinoid X receptor/RXR. The VDR-RXR heterodimers bind to specific response elements on DNA and activate the transcription of vitamin D3-responsive target genes. Plays a central role in calcium homeostasis. Also functions as a receptor for the secondary bile acid lithocholic acid (LCA) and its metabolites.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIF-PIHCELISA
- Clone
- ARC60266
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat