Antibodies
Anti-VEGF 165A Antibody-Oligo Conjugate
SKU: aoc3778
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VEGF 165A Antibody-IF1
Antibody Target
- Target
- Vascular endothelial growth factor A, long form
- UniProt Number
- P15692
- Target Description
- [N-VEGF]: Participates in the induction of key genes involved in the response to hypoxia and in the induction of angiogenesis such as HIF1A. Involved in protecting cells from hypoxia-mediated cell death.; FUNCTION: [VEGFA]: Growth factor active in angiogenesis, vasculogenesis and endothelial cell growth. Induces endothelial cell proliferation, promotes cell migration, inhibits apoptosis and induces permeabilization of blood vessels. Binds to the FLT1/VEGFR1 and KDR/VEGFR2 receptors, heparan sulfate and heparin. Binds to the NRP1/neuropilin-1 receptor. Binding to NRP1 initiates a signaling pathway needed for motor neuron axon guidance and cell body migration, including for the caudal migration of facial motor neurons from rhombomere 4 to rhombomere 6 during embryonic development. Also binds the DEAR/FBXW7-AS1 receptor.; FUNCTION: [Isoform VEGF165B]: Binds to the KDR receptor but does not activate downstream signaling pathways, does not activate angiogenesis and inhibits tumor growth.
- Molecular Weight
- 27kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBELISAIHC
- Clone
- AMC0005
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- MouseRat