AntibodiesNeuroMab
Anti-VGLUT1 Antibody-Oligo Conjugate
SKU: aoc9
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VGLUT1 Antibody-IF1
Antibody Target
- Target
- VGLUT1
- UniProt Number
- Q9P2U7
- Target Description
- Multifunctional transporter that transports L-glutamate as well as multiple ions such as chloride, proton, potassium, sodium and phosphate. At the synaptic vesicle membrane, mainly functions as an uniporter which transports preferentially L-glutamate but also phosphate from the cytoplasm into synaptic vesicles at presynaptic nerve terminals of excitatory neural cells. The L-glutamate or phosphate uniporter activity is electrogenic and is driven by the proton electrochemical gradient, mainly by the electrical gradient established by the vacuolar H(+)-ATPase across the synaptic vesicle membrane. In addition, functions as a chloride channel that allows a chloride permeation through the synaptic vesicle membrane that affects the proton electrochemical gradient and promotes synaptic vesicles acidification. Moreover, may function as a K(+)/H(+) antiport allowing to maintain the electrical gradient and to decrease chemical gradient and therefore sustain vesicular glutamate uptake. The vesicular K(+)/H(+) antiport activity is electroneutral. At the plasma membrane, following exocytosis, functions as a symporter of Na(+) and phosphate from the extracellular space to the cytoplasm allowing synaptic phosphate homeostasis regulation. The symporter activity is driven by an inside negative membrane potential and is electrogenic. Is necessary for synaptic signaling of visual-evoked responses from photoreceptors.
- Molecular Weight
- 52 kDa
- Synonyms
- Vesicular glutamate transporter 1 (VGluT1) (Brain-specific Na(+)-dependent inorganic phosphate cotransporter) (Solute carrier family 17 member 7)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCFlow Cytometry
- Specificity
- Does not cross-react with VGlut2 or VGlut3
- Clone
- N28/9
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 493-560 (cytoplasmic C-terminus) of rat VGlut1 (accession number Q62634) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- FishHumanMouseRat