AntibodiesNeuroMab
Anti-VGlut1 Antibody-Oligo Conjugate
SKU: aoc9
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VGlut1 Antibody-IF1
Antibody Target
- Target
- VGlut1
- UniProt Number
- Q9P2U7
- Target Description
- Vesicular glutamate transporter 1 (Vglut1) is encoded by the gene Slc17a7 and belongs to the vesicular glutamate transporter family. Vglut1 is expressed in glutamatergic neurons in brain regions including the cerebellum, cerebral cortex and hippocampus at synaptic vesicles. Isoform 2 is expressed in retinal. Vglut1 functions to uptake glutamate into synaptic vesicles in excitatory neural cells. Altered expression of Vglut1 has been implicated in several neurological and psychiatric diseases including Alzheimer’s disease, Parkinson’s disease, epilepsy and schizophrenia.
- Molecular Weight
- 52 kDa
- Synonyms
- Vesicular glutamate transporter 1 (VGluT1) (Brain-specific Na(+)-dependent inorganic phosphate cotransporter) (Solute carrier family 17 member 7)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCFlow Cytometry
- Specificity
- Does not cross-react with VGlut2 or VGlut3
- Clone
- N28/9
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 493-560 (cytoplasmic C-terminus) of rat VGlut1 (accession number Q62634) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- FishHumanMouseRat