Antibodies
Anti-Villin Antibody-Oligo Conjugate (ARC54727)
SKU: aoc3785
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Villin Antibody (ARC54727)-IF1
Antibody Target
- Target
- Villin-1
- UniProt Number
- P09327
- Target Description
- Epithelial cell-specific Ca(2+)-regulated actin-modifying protein that modulates the reorganization of microvillar actin filaments. Plays a role in the actin nucleation, actin filament bundle assembly, actin filament capping and severing. Binds phosphatidylinositol 4,5-bisphosphate (PIP2) and lysophosphatidic acid (LPA); binds LPA with higher affinity than PIP2. Binding to LPA increases its phosphorylation by SRC and inhibits all actin-modifying activities. Binding to PIP2 inhibits actin-capping and -severing activities but enhances actin-bundling activity. Regulates the intestinal epithelial cell morphology, cell invasion, cell migration and apoptosis. Protects against apoptosis induced by dextran sodium sulfate (DSS) in the gastrointestinal epithelium. Appears to regulate cell death by maintaining mitochondrial integrity. Enhances hepatocyte growth factor (HGF)-induced epithelial cell motility, chemotaxis and wound repair. Upon S.flexneri cell infection, its actin-severing activity enhances actin-based motility of the bacteria and plays a role during the dissemination.
- Molecular Weight
- 93kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC54727
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat