Antibodies
Anti-VIP Antibody-Oligo Conjugate
SKU: aoc3789
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VIP Antibody-IF1
Antibody Target
- Target
- VIP peptides [Cleaved into: Intestinal peptide PHV-42
- UniProt Number
- P01282
- Target Description
- [Vasoactive intestinal peptide]: VIP is a neuropeptide involved in a diverse array of physiological processes through activating the PACAP subfamily of class B1 G protein-coupled receptors: VIP receptor 1 (VPR1) and VIP receptor 2 (VPR2). Abundantly expressed throughout the CNS and peripheral nervous systems where they primarily exert neuroprotective and immune modulatory roles. Also causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder.; FUNCTION: PHM-27 and PHV-42 are two bioactive forms from proteolysis of the same precursor protein, that cause vasodilation. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin.
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC65218
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human