Antibodies
Anti- VIRMA/KIAA1429 Antibody-Oligo Conjugate
SKU: aoc1026
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti- VIRMA/KIAA1429 Antibody-IF1
Antibody Target
- Target
- Protein virilizer homolog
- UniProt Number
- Q69YN4
- Target Description
- Associated component of the WMM complex, a complex that mediates N6-methyladenosine (m6A) methylation of RNAs, a modification that plays a role in the efficiency of mRNA splicing and RNA processing (PubMed:24981863, PubMed:29507755). Acts as a key regulator of m6A methylation by promoting m6A methylation of mRNAs in the 3'-UTR near the stop codon: recruits the catalytic core components METTL3 and METTL14, thereby guiding m6A methylation at specific sites (PubMed:29507755). Required for mRNA polyadenylation via its role in selective m6A methylation: m6A methylation of mRNAs in the 3'-UTR near the stop codon correlating with alternative polyadenylation (APA) (PubMed:29507755)..
- Molecular Weight
- 202kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC73894
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse