Antibodies
Anti-Von Willebrand Factor Antibody-Oligo Conjugate (ARC52173)
SKU: aoc3794
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Von Willebrand Factor Antibody (ARC52173)-IF1
Antibody Target
- Target
- von Willebrand factor
- UniProt Number
- P04275
- Target Description
- Important in the maintenance of hemostasis, it promotes adhesion of platelets to the sites of vascular injury by forming a molecular bridge between sub-endothelial collagen matrix and platelet-surface receptor complex GPIb-IX-V. Also acts as a chaperone for coagulation factor VIII, delivering it to the site of injury, stabilizing its heterodimeric structure and protecting it from premature clearance from plasma.
- Molecular Weight
- 309kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC52173
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse