Antibodies
Anti-VPS11 Antibody-Oligo Conjugate
SKU: aoc3795
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VPS11 Antibody-IF1
Antibody Target
- Target
- Vacuolar protein sorting-associated protein 11 homolog
- UniProt Number
- Q9H270
- Target Description
- Plays a role in vesicle-mediated protein trafficking to lysosomal compartments including the endocytic membrane transport and autophagic pathways. Believed to act as a core component of the putative HOPS and CORVET endosomal tethering complexes which are proposed to be involved in the Rab5-to-Rab7 endosome conversion probably implicating MON1A/B, and via binding SNAREs and SNARE complexes to mediate tethering and docking events during SNARE-mediated membrane fusion. The HOPS complex is proposed to be recruited to Rab7 on the late endosomal membrane and to regulate late endocytic, phagocytic and autophagic traffic towards lysosomes. The CORVET complex is proposed to function as a Rab5 effector to mediate early endosome fusion probably in specific endosome subpopulations. Required for fusion of endosomes and autophagosomes with lysosomes. Involved in cargo transport from early to late endosomes and required for the transition from early to late endosomes. Involved in the retrograde Shiga toxin transport.
- Molecular Weight
- 108kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2325
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse