Antibodies
Anti-VPS15 Antibody-Oligo Conjugate
SKU: aoc3796
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-VPS15 Antibody-IF1
Antibody Target
- Target
- Phosphoinositide 3-kinase regulatory subunit 4
- UniProt Number
- Q99570
- Target Description
- Regulatory subunit of the PI3K complex that mediates formation of phosphatidylinositol 3-phosphate; different complex forms are believed to play a role in multiple membrane trafficking pathways: PI3KC3-C1 is involved in initiation of autophagosomes and PI3KC3-C2 in maturation of autophagosomes and endocytosis. Involved in regulation of degradative endocytic trafficking and cytokinesis, probably in the context of PI3KC3-C2.
- Molecular Weight
- 153kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2090
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse