Antibodies
Anti-WEE1 Antibody-Oligo Conjugate
SKU: aoc3807
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-WEE1 Antibody-IF1
Antibody Target
- Target
- Wee1-like protein kinase
- UniProt Number
- P30291
- Target Description
- Acts as a negative regulator of entry into mitosis (G2 to M transition) by protecting the nucleus from cytoplasmically activated cyclin B1-complexed CDK1 before the onset of mitosis by mediating phosphorylation of CDK1 on 'Tyr-15'. Specifically phosphorylates and inactivates cyclin B1-complexed CDK1 reaching a maximum during G2 phase and a minimum as cells enter M phase. Phosphorylation of cyclin B1-CDK1 occurs exclusively on 'Tyr-15' and phosphorylation of monomeric CDK1 does not occur. Its activity increases during S and G2 phases and decreases at M phase when it is hyperphosphorylated. A correlated decrease in protein level occurs at M/G1 phase, probably due to its degradation.
- Molecular Weight
- 72kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC57004
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Mouse