Antibodies
Anti-WNK3 Antibody-Oligo Conjugate
SKU: aoc3813
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-WNK3 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase WNK3
- UniProt Number
- Q9BYP7
- Target Description
- Serine/threonine-protein kinase component of the WNK3-SPAK/OSR1 kinase cascade, which plays an important role in the regulation of electrolyte homeostasis and regulatory volume increase in response to hyperosmotic stress. WNK3 mediates regulatory volume increase in response to hyperosmotic stress by acting as a molecular crowding sensor, which senses cell shrinkage and mediates formation of a membraneless compartment by undergoing liquid-liquid phase separation. The membraneless compartment concentrates WNK3 with its substrates, OXSR1/OSR1 and STK39/SPAK, promoting WNK3-dependent phosphorylation and activation of downstream kinases OXSR1/OSR1 and STK39/SPAK. Following activation, OXSR1/OSR1 and STK39/SPAK catalyze phosphorylation of ion cotransporters SLC12A1/NKCC2, SLC12A2/NKCC1, SLC12A3/NCC, SLC12A4/KCC1, SLC12A5/KCC2 or SLC12A6/KCC3, regulating their activity. Phosphorylation of Na-K-Cl cotransporters SLC12A2/NKCC1 and SLC12A2/NKCC1 promote their activation and ion influx; simultaneously, phosphorylation of K-Cl cotransporters SLC12A4/KCC1, SLC12A5/KCC2 and SLC12A6/KCC3 inhibits its activity, blocking ion efflux. Phosphorylates WNK4, possibly regulating the activity of SLC12A3/NCC. May also phosphorylate NEDD4L. Also acts as a scaffold protein independently of its protein kinase activity: negatively regulates cell membrane localization of various transporters and channels, such as KCNJ1 and SLC26A9. Increases Ca(2+) influx mediated by TRPV5 and TRPV6 by enhancing their membrane expression level via a kinase-dependent pathway.
- Molecular Weight
- 198 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC60764
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat